View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_62 (Length: 312)
Name: NF0611_low_62
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 254
Target Start/End: Original strand, 16471359 - 16471609
Alignment:
| Q |
5 |
gagtgagaagaaagatttctaatttcataaccacctccacaatacactaacacaattaagatactaacatagaccaattcaaaaaagatcatgtaaagca |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16471359 |
gagtgacaagaaagatttctaatttcattaccacctccaacatacactaacaaaattaagatactaacatagaccaattcaaaaaagatcatgtaaagca |
16471458 |
T |
|
| Q |
105 |
tgtgacgtgtctaatagaaatccaatatgtttgtttccttaacaaatatcctcttttcagatttactttcacatcacttgggtgaccggtcactttatat |
204 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16471459 |
tatgacgtgtctaatagaaatccaatatgtttgtttctttaacaaatatcctcttttcagatttacattcacatcacttgggtgaccggtcactttatac |
16471558 |
T |
|
| Q |
205 |
taaaactt-agagtcatcaatggtcaacctataacaatgacaattattgta |
254 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16471559 |
taaaacttgagagtcatcaatggtcaacctataacaatgacaattattgta |
16471609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3057 times since January 2019
Visitors: 3831