View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_65 (Length: 277)
Name: NF0611_low_65
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 35949623 - 35949869
Alignment:
| Q |
1 |
ttcccctccaatccatacttgtttaggaaacatgtagagaatgttttgctgttgtgcaagtcttctataggcgtcaccacctcttagcacttctggcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35949623 |
ttcccctccaatccatacttgtttaggaaacatgtagagaatgttttggtggtgtgcaagtcttctataggcgtcaccacctcttagcacttctggcctc |
35949722 |
T |
 |
| Q |
101 |
tgggcggtttgaagttagctcaccgcgattcactttgaagtacttgtaacctgcttttggattgcaggttgtttggttttgtcgggttttgttgttacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35949723 |
tgggcggtttgaagttagctcaccgcgattcactttgaagtacttgtaacctgcttttggattgcaggttgtttggttttgtcgggttttgttgttacac |
35949822 |
T |
 |
| Q |
201 |
cgctatgtattcaccatcgtgttgatgtgttgcctccttgatctctg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35949823 |
cgctatgtattcaccatcgtgttgatgtgttgcctccttgatctctg |
35949869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University