View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_68 (Length: 271)
Name: NF0611_low_68
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 37 - 172
Target Start/End: Complemental strand, 34578398 - 34578263
Alignment:
| Q |
37 |
gagggcattgttttagatgttacaccaagtgcaggcaagtcatttcacgaagatgtaaatagaaggaaggccatgtttcctgaaactggcatgtcagcaa |
136 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34578398 |
gagggaattgttttagatgttacaccaagtgcaggcaagtcatttcacgaagatgtaaatagaaggaaggccatgtttcctgaaactggcatgtcagcaa |
34578299 |
T |
|
| Q |
137 |
aaaatgttaatattttgaggtaaggctgctgccgct |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34578298 |
aaaatgttaatattttgaggtaaggctgctgccgct |
34578263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2384 times since January 2019
Visitors: 3818