View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_72 (Length: 263)
Name: NF0611_low_72
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0611_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 68 - 253
Target Start/End: Original strand, 15379609 - 15379794
Alignment:
| Q |
68 |
tcacgggatatttgttgtaataggataaaatatgtatattgtttgaaaagcaaaattaannnnnnnnacattttataaaattataaatccaagggagttt |
167 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15379609 |
tcacaggatatttgttgtaataggataaaaaatgtatattgtttgaaaagcaaaattaattttttttacattttataaaattataaatccaagggagttt |
15379708 |
T |
|
| Q |
168 |
ctttgatctcatcgtctgcaagagccttctcaatagtgacatttacaggtatatttccttgctcaaacattttttatttatctctg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15379709 |
ctttgatctcatcgtctgcaagagccttctcagtagtgacatttacaggtatatttccttgctcaaacattttttatttatttctg |
15379794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2505 times since January 2019
Visitors: 3819