View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0611_low_77 (Length: 251)

Name: NF0611_low_77
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0611_low_77
NF0611_low_77
[»] chr1 (1 HSPs)
chr1 (1-244)||(15379831-15380074)


Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 15379831 - 15380074
Alignment:
1 tatgttccaatagcacccttctttttatgatccaagttgcatgacaaaagaccaccagctatgcttccaccagtagtggagcaactgatagctttaaata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15379831 tatgttccaatagcacccttctttttatgatccaagttgcatgacaaaagaccaccagctatgcttccaccagtagtggagcaactgatagctttaaata 15379930  T
101 gagtaagatttctcattgaaaagaagattcagcgatggatggaatcgggatgatccatgggatatgctgaactattgccatttagtttaagtttttgatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
15379931 gagtaagatttctcattgaaaagaagattcagcgatggatggaatcgggatgatccatgtgatatgctgaactattgccatttagtttaagtttttgatg 15380030  T
201 aatgatcgtaagaataacctaatcttatttcttatcctttgcta 244  Q
    ||||||||||| ||||||||||||||||||||||||||||||||    
15380031 aatgatcgtaacaataacctaatcttatttcttatcctttgcta 15380074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University