View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_85 (Length: 227)
Name: NF0611_low_85
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_low_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 15642630 - 15642766
Alignment:
Q |
1 |
aacacaatattatattattgtagttcctctcaatacagttatttttctgccattaccaaataaaaacaaaactcactatattcattcaaagaaactacaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
T |
15642630 |
aacacaatattatattattgtagttcctctcaatacagttatttttctgtcattactaaataaaaacaaaattcactatattc-ttcaaagaagctacaa |
15642728 |
T |
 |
Q |
101 |
atatgcagtcataatcttaatattacttttgacttttg |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
15642729 |
atatgcagtcataatcttaatattacttttgacttttg |
15642766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2727 times since January 2019
Visitors: 3823