View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0611_low_85 (Length: 227)

Name: NF0611_low_85
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0611_low_85
NF0611_low_85
[»] chr5 (1 HSPs)
chr5 (1-138)||(15642630-15642766)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 15642630 - 15642766
Alignment:
1 aacacaatattatattattgtagttcctctcaatacagttatttttctgccattaccaaataaaaacaaaactcactatattcattcaaagaaactacaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||| ||||||||| ||||||    
15642630 aacacaatattatattattgtagttcctctcaatacagttatttttctgtcattactaaataaaaacaaaattcactatattc-ttcaaagaagctacaa 15642728  T
101 atatgcagtcataatcttaatattacttttgacttttg 138  Q
    ||||||||||||||||||||||||||||||||||||||    
15642729 atatgcagtcataatcttaatattacttttgacttttg 15642766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2727 times since January 2019
Visitors: 3823