View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0611_low_86 (Length: 204)

Name: NF0611_low_86
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0611_low_86
NF0611_low_86
[»] chr4 (1 HSPs)
chr4 (131-192)||(41276282-41276343)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 131 - 192
Target Start/End: Original strand, 41276282 - 41276343
Alignment:
131 ggtagaatgttaattattttttgtcacatatattactataccaattgttaatgtataatatt 192  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
41276282 ggtagaatgttaattattttttatcacatatattactataccaattgttaatgtataatatt 41276343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University