View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0611_low_86 (Length: 204)
Name: NF0611_low_86
Description: NF0611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0611_low_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 131 - 192
Target Start/End: Original strand, 41276282 - 41276343
Alignment:
Q |
131 |
ggtagaatgttaattattttttgtcacatatattactataccaattgttaatgtataatatt |
192 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41276282 |
ggtagaatgttaattattttttatcacatatattactataccaattgttaatgtataatatt |
41276343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2878 times since January 2019
Visitors: 3829