View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0612_high_4 (Length: 321)

Name: NF0612_high_4
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0612_high_4
NF0612_high_4
[»] chr7 (3 HSPs)
chr7 (232-306)||(38914341-38914415)
chr7 (139-201)||(38913874-38913936)
chr7 (36-67)||(38913810-38913841)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 232 - 306
Target Start/End: Original strand, 38914341 - 38914415
Alignment:
232 tcatatatacttgtgaggggagcctcctagttttagttattctggactcatgtatgctcccggtccttattatat 306  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
38914341 tcatatatacttgtgaggggagcctcctagttttagttattctgaactcatgtatgctcccggtccttattatat 38914415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 139 - 201
Target Start/End: Original strand, 38913874 - 38913936
Alignment:
139 ggatcttagataatgtgaattaattaaaaataactgaagataatgaatagacatgggaagaag 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38913874 ggatcttagataatgtgaattaattaaaaataactgaagataatgaatagacatgggaagaag 38913936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 36 - 67
Target Start/End: Original strand, 38913810 - 38913841
Alignment:
36 agctttgtaaataatagctaaatgtaaaagcc 67  Q
    ||||||||||||||||||||||||||||||||    
38913810 agctttgtaaataatagctaaatgtaaaagcc 38913841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University