View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_high_5 (Length: 276)
Name: NF0612_high_5
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0612_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 45097053 - 45096786
Alignment:
| Q |
1 |
ttcctctacgtccttctatttcattctattcacatttacagagcagtaaatcaatgtgctgattagcttgctaatcttcgtttaagtttgagttcttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45097053 |
ttcctctacgtccttctatttcattctattcacatttacagagcagtaaatcaacgtgctgattagcttgctaatcttcgtttaagtttgagttcttatg |
45096954 |
T |
|
| Q |
101 |
cttggtggtctcagttgcctaaccaaattagagacgattatattagaaatagattaggttttgcaatttacgattttgttagctctttttgagggtttgg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45096953 |
cttggtggtttcagttgcctaaccaaattagagacgactatattagaaatagattaggttttacaatttacgattttgttagctctttttgagggtttgg |
45096854 |
T |
|
| Q |
201 |
tcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcatctc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45096853 |
tcttatatcccattcttttcattgtacctttttagcttatcaatgtattttgggtcttgcttcatctc |
45096786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2091 times since January 2019
Visitors: 3811