View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_low_13 (Length: 296)
Name: NF0612_low_13
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0612_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 106 - 214
Target Start/End: Original strand, 49562358 - 49562466
Alignment:
| Q |
106 |
aatatgcactcacaacttatcaaagcagcagtcagcagaagctagcatcctccccccgatatagctttaatagacaatatgcttcctcctcaaaacgatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49562358 |
aatatgcactcacaacttatcaaagcagcagtcagcagatgctagcatcctccccccgatatagctctaatagacaatatgcttcctcctcaaaacgatt |
49562457 |
T |
|
| Q |
206 |
cacatacct |
214 |
Q |
| |
|
||||||||| |
|
|
| T |
49562458 |
cacatacct |
49562466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2832 times since January 2019
Visitors: 3829