View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_low_19 (Length: 256)
Name: NF0612_low_19
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0612_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 877723 - 877541
Alignment:
Q |
14 |
agagtgatgggagagagagtattatggaaaaattgaagtaatcgtgaggctagaatttgatcttaaagggaaaaaggatcttggctattgatttggagtt |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
877723 |
agagtgatgggagagagagtattatggaaaaattgaagtaatcgtgaggctagaatttgatcttaaagggaaaaaggatcttggctattgatttggagtt |
877624 |
T |
 |
Q |
114 |
tataatttctttatgattttgccggcactctcttttcttaaatgaagagataaacatcactaaaattcacatacacaatttcc |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
877623 |
tataatttctttatgattttgccggcactctcttttcttaaatgaagagataaacatcactataattcacatacacaatttcc |
877541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University