View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_low_20 (Length: 252)
Name: NF0612_low_20
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0612_low_20 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 124 - 252
Target Start/End: Original strand, 14091030 - 14091156
Alignment:
| Q |
124 |
atgcacgtactagtactataataatatttactctannnnnnncttggtcagaatatttactcttttttattagtaagttgttgaaatgatcagggtggtg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14091030 |
atgcacgtactagtactataataatatttactctatttttttcttggtcagaatatttactcttttttattagtaagtcgttgaaatgatcagggtggtg |
14091129 |
T |
|
| Q |
224 |
attactatactatagtacgaagagagtaa |
252 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
14091130 |
atta--ttactatagtacgaagagagtaa |
14091156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2801 times since January 2019
Visitors: 3829