View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0612_low_22 (Length: 236)

Name: NF0612_low_22
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0612_low_22
NF0612_low_22
[»] chr1 (1 HSPs)
chr1 (115-148)||(621717-621750)


Alignment Details
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 148
Target Start/End: Original strand, 621717 - 621750
Alignment:
115 caatattcctatacaagttgttcaacatgacttg 148  Q
    |||| |||||||||||||||||||||||||||||    
621717 caattttcctatacaagttgttcaacatgacttg 621750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University