View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_low_22 (Length: 236)
Name: NF0612_low_22
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0612_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 148
Target Start/End: Original strand, 621717 - 621750
Alignment:
| Q |
115 |
caatattcctatacaagttgttcaacatgacttg |
148 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
621717 |
caattttcctatacaagttgttcaacatgacttg |
621750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2523 times since January 2019
Visitors: 3821