View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_low_5 (Length: 419)
Name: NF0612_low_5
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0612_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 93 - 413
Target Start/End: Complemental strand, 43625183 - 43624865
Alignment:
| Q |
93 |
atttttaatgtcaaattgtgtcttcataatctgaaattggggatcacaaatcagcaactcacgcggggtataacacctgcatgattgtgtacacagcctc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43625183 |
atttttaatgtcaaattgtgtcttcataacctgaaattggggatcacaaatcagcaacttacgcggggtataacacctgcatgattgtgtacatagcctc |
43625084 |
T |
|
| Q |
193 |
ttctgacgatccctgaaagtcagaatattcactgtcaacatacccccaatataaaggatccacggtacacatcatatccctttggtcccttgcctttatc |
292 |
Q |
| |
|
||| |||||||||||| |||||||||||||| ||||||||| |||||||||| ||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43625083 |
ttc-gacgatccctgagagtcagaatattcagtgtcaacatgcccccaatatgaaggatc-acggtacacatcatatccctctggtcccttgcctttatc |
43624986 |
T |
|
| Q |
293 |
cttcttcactcatcctttggttttaactttgttgggaggtggacacatggaactacaagctccaatttctttaggttgtataattgtttcccttttcata |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43624985 |
cttcttcactcatcctttggttttaactttgttgggaggtggacacatggaactacaagctccaatttctttaggttgtataattgtttcccttttcata |
43624886 |
T |
|
| Q |
393 |
gcatgaaattcttcatctcac |
413 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
43624885 |
gcatgaaattcttcatttcac |
43624865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 352 - 400
Target Start/End: Complemental strand, 26413187 - 26413139
Alignment:
| Q |
352 |
ctccaatttctttaggttgtataattgtttcccttttcatagcatgaaa |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26413187 |
ctccaatttctttaggttgtataattgtttcccttttcatagcatgaaa |
26413139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1942 times since January 2019
Visitors: 3810