View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0612_low_6 (Length: 380)
Name: NF0612_low_6
Description: NF0612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0612_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 54 - 374
Target Start/End: Complemental strand, 43625183 - 43624865
Alignment:
| Q |
54 |
atttttaatgtcaaattgtgtcttcataatctgaaattggggatcacaaatcagcaactcacgcggggtataacacctgcatgattgtgtacacagcctc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43625183 |
atttttaatgtcaaattgtgtcttcataacctgaaattggggatcacaaatcagcaacttacgcggggtataacacctgcatgattgtgtacatagcctc |
43625084 |
T |
 |
| Q |
154 |
ttctgacgatccctgaaagtcagaatattcactgtcaacatacccccaatataaaggatccacggtacacatcatatccctttggtcccttgcctttatc |
253 |
Q |
| |
|
||| |||||||||||| |||||||||||||| ||||||||| |||||||||| ||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43625083 |
ttc-gacgatccctgagagtcagaatattcagtgtcaacatgcccccaatatgaaggatc-acggtacacatcatatccctctggtcccttgcctttatc |
43624986 |
T |
 |
| Q |
254 |
cttcttcactcatcctttggttttaactttgttgggaggtggacacatggaactacaagctccaatttctttaggttgtataattgtttcccttttcata |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43624985 |
cttcttcactcatcctttggttttaactttgttgggaggtggacacatggaactacaagctccaatttctttaggttgtataattgtttcccttttcata |
43624886 |
T |
 |
| Q |
354 |
gcatgaaattcttcatctcac |
374 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
43624885 |
gcatgaaattcttcatttcac |
43624865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 313 - 361
Target Start/End: Complemental strand, 26413187 - 26413139
Alignment:
| Q |
313 |
ctccaatttctttaggttgtataattgtttcccttttcatagcatgaaa |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26413187 |
ctccaatttctttaggttgtataattgtttcccttttcatagcatgaaa |
26413139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University