View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_16 (Length: 318)
Name: NF0613_low_16
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0613_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 99 - 240
Target Start/End: Original strand, 32958671 - 32958812
Alignment:
| Q |
99 |
caatgatgaggagacaatattattcttagggtttggatcagagtttgatggtttttgatatacttgttctttctctttgaccatccaaccaccagattgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32958671 |
caatgatgaggagacaatattattcttagggtctgggtcagagtttgatggtttttgatatacttgttctttttctttgaccatccaaccaccagattgg |
32958770 |
T |
|
| Q |
199 |
tttccaggttgggttggatgctcaaacattatcccaatctct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958771 |
tttccaggttgggttggatgctcaaacattatcccaatctct |
32958812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 236
Target Start/End: Original strand, 24862187 - 24862244
Alignment:
| Q |
179 |
ccatccaaccaccagattggtttccaggttgggttggatgctcaaacattatcccaat |
236 |
Q |
| |
|
||||||||||||| |||||||| || ||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
24862187 |
ccatccaaccacctgattggttacctggttgtgttggatgttcaaacactatgccaat |
24862244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2028 times since January 2019
Visitors: 3811