View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_19 (Length: 286)
Name: NF0613_low_19
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0613_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 45 - 283
Target Start/End: Original strand, 3253387 - 3253625
Alignment:
Q |
45 |
catcatcaaacagaaccacacaacacatctctccattatattccatcaatttgaatctttattgcaataaaacttaatcatgaatcaattgatgcataat |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3253387 |
catcatcaaacagaaccacacaacacatctctccattatattccatcaatttgaatctttattgcaataaaacttaatcatgaatcaattgatgcataat |
3253486 |
T |
 |
Q |
145 |
ataaccttaatcacaaatcagttgaaacctaatcaaacctgaatgaaggttgaatcactgtatgaacgaaaccgagtattggggtaaaatggaatcacaa |
244 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3253487 |
agaaccttaatcacaaatcagttgaaacctaatcaaacctgaatgaaggttgaatcactgtatgaacgaaaccgagtattggggtaaaatggaatcacaa |
3253586 |
T |
 |
Q |
245 |
acatatcttgggatcgatgcgtatggtaaatcctaaaat |
283 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3253587 |
acatatcttgggatcgatgcgtatggtaaatcctaaaat |
3253625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University