View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_20 (Length: 275)
Name: NF0613_low_20
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0613_low_20 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 7 - 275
Target Start/End: Original strand, 38832751 - 38833017
Alignment:
Q |
7 |
ggatcttcttcttgcatcatctctgttttctgatgcaattttcgtatttaaaacgacacaacttgttttcttttagcaaaaaacaacactacttgttatg |
106 |
Q |
|
|
|||| |||||||||||||||||||| || ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38832751 |
ggatgttcttcttgcatcatctctggattatgatgcattttttgtatttaaaacgacacaacttgttttcttttagcaaaaaacaacactacttgttatg |
38832850 |
T |
 |
Q |
107 |
aaagtaaaaaatggcaggtgatggcagaagaatgccctcaacgggacatggtcaaattcactagatcatatggtcctataataattataacagtggtgtt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| || |
|
|
T |
38832851 |
aaagtaaaaaatggcaggtgatggcagaagaatgccctcaacgggacatggtcaaattcactagatcatatggtcc--taataattaaaacagtggtatt |
38832948 |
T |
 |
Q |
207 |
aatagcggtaatgttgacccaaaaaagaacgtaataggaatgagccgtgataaaggtttctagttcata |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38832949 |
aatagcggtaatgttgacccaaaaaagaacgtaataggaatgagccgtgataaaggtttctagttcata |
38833017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2211 times since January 2019
Visitors: 3815