View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_21 (Length: 259)
Name: NF0613_low_21
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0613_low_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 28 - 259
Target Start/End: Complemental strand, 3253883 - 3253649
Alignment:
| Q |
28 |
catgaactacaatcttggagtttgtagagaaaatcacattatcaaatccaagctctc--gagtcttgacccaatgaatcgcagcaagtagcatgttcgct |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3253883 |
catgaactacaatcttggagtttgtagagaaaatcacattatcaaatccaagctctcttgagtcttgacccaatgaatcgcagcaagtagcatgttcgct |
3253784 |
T |
|
| Q |
126 |
ttgcctatgggaacagaaaaata-ggttctagccacatcgttttagctcaaacaaaaaaccctatttcatctcttatacgttacactattaaagcttgta |
224 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3253783 |
ttgcctatgggaacagaaaaaaaaggttctagccacatcgttttagctcaaacaaaaaaccctatttcatctcttatacgttacactattaaagcttgta |
3253684 |
T |
|
| Q |
225 |
taaaagcgaaacatatacattacacttcataaaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3253683 |
taaaagcgaaacatatacattacacttcataaaat |
3253649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 34 - 203
Target Start/End: Complemental strand, 27757055 - 27756893
Alignment:
| Q |
34 |
ctacaatcttggagtttgtagagaaaatcacattatcaaatccaagctctcgagtcttgacccaatgaatcgcagcaagtagcatgttcgctttgcctat |
133 |
Q |
| |
|
||||||| ||||||| |||||||||||| | |||||||||||||||||||| ||||||||||||| ||| || |||| ||| ||| | |||| |
|
|
| T |
27757055 |
ctacaattttggagtgtgtagagaaaattatattatcaaatccaagctctc------tgacccaatgaattgcaacaggtagtgctttcacttcggctat |
27756962 |
T |
|
| Q |
134 |
gggaacagaaaaataggttctagccacatcgttttagctcaaacaaaaaaccctatttcatctcttatac |
203 |
Q |
| |
|
| |||| |||||| ||||| || ||||||||||||| ||| ||||||| |||||||| |||||||||| |
|
|
| T |
27756961 |
gtgaac-gaaaaaaaggttttaaccacatcgttttatctccaacaaaagcccctatttattctcttatac |
27756893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2512 times since January 2019
Visitors: 3819