View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_23 (Length: 247)
Name: NF0613_low_23
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0613_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 39930397 - 39930295
Alignment:
| Q |
1 |
ttcttcactttctatgttgcttcaggagctgcattaactggagttatttacattgaagataatttgggttgggctataggatttggtatttgtgttgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39930397 |
ttcttcactttctatgttgcttcaggagctgcattaactggaattatttacattgaagataatttgggttgggctataggatttggtatttgtgctgtgg |
39930298 |
T |
|
| Q |
101 |
ctg |
103 |
Q |
| |
|
||| |
|
|
| T |
39930297 |
ctg |
39930295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 39692936 - 39693031
Alignment:
| Q |
8 |
ctttctatgttgcttcaggagctgcattaactggagttatttacattgaagataatttgggttgggctataggatttggtatttgtgttgtggctg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
39692936 |
ctttctatgttgcttcaggagctgcattaactggaattatttacattgaagataatttgggttgggctacaggatttggtatctgtgttgtggctg |
39693031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 39702905 - 39703003
Alignment:
| Q |
4 |
ttcactttctatgttgcttcaggagctgcattaactggagttatttacattgaagataatttgggttgggctataggatttggtatttgtgttgtggct |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||| |
|
|
| T |
39702905 |
ttcactttctatgttgcttctggagctgcattaactggagttatttacattgaagataatttgggttggtctttaggatttggtatctgtgctgtggct |
39703003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1979 times since January 2019
Visitors: 3810