View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_8 (Length: 387)
Name: NF0613_low_8
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0613_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 29 - 377
Target Start/End: Complemental strand, 15969364 - 15969021
Alignment:
| Q |
29 |
attatcagtgtcgacgtgtccgagtacgtgctcataaaaatacaagagaatttgcaaaatggagaaatatagatatgttatgaaactaaacatggttgat |
128 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15969364 |
attatcagtgtcgacgtgtccgagtatgtgctcataaaaatacaagagaatttgcaaaatggagaaatatagatatgttatgaaactaaacatggttgat |
15969265 |
T |
|
| Q |
129 |
taatgtgtacctggagatggaatgagattgtagaagacaaagttgactttgatttggatctgtaattgaatttgaattaattaatcaaaatggaaagcga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15969264 |
taatgtgtacctggagatggaatgagattgcagaagacaaagttgactttgatttggatctgtaattgaatttgaattaattaatcaaaatggaaagcga |
15969165 |
T |
|
| Q |
229 |
aaagttcttgcggaattacaaggtatcttctgctaacattgggatctgggtggggactggggaaggggaagggtgggacccaaaacgacatgtagattca |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15969164 |
aaagttcttgcggaattacaaggtatcttctgctaacattgggatctgggtggggactggggaaggggaagggtgggacccaaaacgacatgtagattca |
15969065 |
T |
|
| Q |
329 |
gaatgttgtgtgaagggaagggagttatattgtacattacttgtctgtg |
377 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
15969064 |
gaatgttgtat-----gaagggagttatattgtacattacttgtttgtg |
15969021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2019 times since January 2019
Visitors: 3810