View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0613_low_9 (Length: 376)
Name: NF0613_low_9
Description: NF0613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0613_low_9 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 20 - 376
Target Start/End: Original strand, 49087368 - 49087724
Alignment:
Q |
20 |
catctcccccctgacaaactacaaatgaacaaacctgctggtccaccaccttcttcttcctacggcacaagttcttccggacgtgcttttgccacattcc |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087368 |
catctcccccctgacaaactacaaatgaacaaacctgctggtccaccaccttcttcttcctacggcacaagttcttccggacgtgcttttgccacattcc |
49087467 |
T |
 |
Q |
120 |
tcaccatctttctcctactaatcggtgtcactctacttgttctctggcttgtctaccgtccacacaaaccccacttcacggttgtcggtgctgccatcta |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087468 |
tcaccatctttctcctactaatcggtgtcactctacttgttctctggcttgtctaccgtccacacaaaccccacttcacggttgtcggtgctgccatcta |
49087567 |
T |
 |
Q |
220 |
tggcttcaacacaccctcacccccgctcctttccgcccccttgcagttcaacatcctcattaagaacccaaacaagcgtgtctctgcttactatgacagg |
319 |
Q |
|
|
||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087568 |
tggcttcaacacaacctcaccaccgctcctttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtctctgcttactatgacagg |
49087667 |
T |
 |
Q |
320 |
ttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccg |
376 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087668 |
ttctctgcttttgtgtcctataggaaccaagccataacaccgcaggttatgcttccg |
49087724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University