View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_high_7 (Length: 366)
Name: NF0614_high_7
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0614_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 119 - 356
Target Start/End: Original strand, 46998558 - 46998795
Alignment:
| Q |
119 |
actttggaacatttgacgccactttcacccatgtcagtgttgatggaaaccccaaaatccgacacattcgtctatcttctacaatccgctatcaaatcca |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46998558 |
actttagaacatttgacgccactttcacccatgtcagtgttgatggaaaccccaaaatccgacacattcgtctatcttctacaatccgctatcaaatcca |
46998657 |
T |
 |
| Q |
219 |
gagacactgtcacaggaagattcattcacgctcgaatcatcaaacacggtcttcacctcagcgttttcttgatgaacaatcttctaaatttctactcaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46998658 |
gagacactgtcacaggaagattcattcacgctcgaatcatcaaacacggtcttcacctcagcgttttcttgatgaacaatcttctaaatttctactcaaa |
46998757 |
T |
 |
| Q |
319 |
aaccgcctctttcaacgatgcacaccgtctattctctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46998758 |
aaccgcctctttcaacgatgcacaccgtctattctctg |
46998795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University