View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_low_12 (Length: 293)
Name: NF0614_low_12
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0614_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 1612461 - 1612214
Alignment:
Q |
1 |
ttaagtcggacgttgtgattgaatatcaaacgcggatttctccacacacgtatgagnnnnnnnnnnn------ggatatatatgaaacgaacgtgtatct |
94 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
1612461 |
ttaagtcggacgttgtgattgaatttcaaacgcggatttctccacacacgtatgagtttttttttttttttttggatatatatgaaacgaacgtgtatct |
1612362 |
T |
 |
Q |
95 |
aaaatggtaaatatccgattcaagagattgagattagtatttgtagttgtgcagagaagttatctacttggcacaaaaagtgtttctgaatacttaacac |
194 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1612361 |
aaaatggtaaatatcggattcaagagattgagattagtatttgtagttgtgcagagaagttatctacttggcacaaaaagtgtttctgaatacttaacac |
1612262 |
T |
 |
Q |
195 |
acatgctgccaacgtaagtgtttggtttgtttgtttttattctctgtg |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1612261 |
acatgctgccaacgtaagtgtttggtttgtttgtttttattctctgtg |
1612214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2224 times since January 2019
Visitors: 3815