View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_low_16 (Length: 275)
Name: NF0614_low_16
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0614_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 40290362 - 40290608
Alignment:
| Q |
1 |
aagaatgtatcaaatgacagactcttcttaaacacctttagactaggcttcaattcacataccctctctttcttttcacagcataatacactttaaccat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40290362 |
aagaatatatcaaatgacagactcttcttaaacacctttagactaggcttcaattcacatactctctctttcttttcacaacataatacactttaaccat |
40290461 |
T |
|
| Q |
101 |
taatggtatactcctttccacacactagttaagaaacatatttaatttgttgattatatatatcaaatgacaaactcttcttgaacacctttagaccagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40290462 |
taatggtatactcctttccacacactagttaagaaacatatttaatttgttgattatatacatcaaatgacaaactcttcttgaacacctttagaccagg |
40290561 |
T |
|
| Q |
201 |
cttcaattcatatactctctctttcttttcacaatataatacctttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40290562 |
cttcaattcatatactctctctttcttttcacaatataatacctttg |
40290608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2387 times since January 2019
Visitors: 3818