View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_low_17 (Length: 274)
Name: NF0614_low_17
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0614_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 10413366 - 10413215
Alignment:
| Q |
1 |
tcatcacgaccattggacacttctcctatctttaaagaatctgttaaactcatcggttacaagtatggatccactcatttttatcgagatttttctccat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
10413366 |
tcatcacgaccatttgacacttctcctatcttcaaagaatctgttaaactcatcggccacaagtatggatccactcatgtttatcgagatttttctccgt |
10413267 |
T |
|
| Q |
101 |
ttgcaagaggtaaagatcttttttataaatcaggagaaaagacagatatcaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
10413266 |
ttgcaagaggtaaagatcttttttataagttaggagaaatgacagatatcaa |
10413215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2082 times since January 2019
Visitors: 3811