View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_low_18 (Length: 273)
Name: NF0614_low_18
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0614_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 29 - 215
Target Start/End: Original strand, 11364490 - 11364669
Alignment:
| Q |
29 |
aagatcaaattcaaagcctgaaaagttttttcaaagtgaagaaaaacgtatacagtgaatactgtttcaccacataggattgtctgaatttcagactcat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11364490 |
aagatcaaattcaaagcctgaaaagttttttcaaagggaagaaaaacatatacagtgaatactgtttcaccacataggattgtctgaatttcagact--- |
11364586 |
T |
|
| Q |
129 |
gaaaaacatagaaaaatcgaacaatgaagcagttaaaggcaacaaaaggataatattgccaatggtgtcccagaactgttgccccaa |
215 |
Q |
| |
|
|||| | | |||||||||||||||||||| ||||||||||||| || |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
11364587 |
----aacaaatagaaatcgaacaatgaagcagtaaaaggcaacaaaaatatgatattggcaatggtgtcccagaactgttaccccaa |
11364669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2696 times since January 2019
Visitors: 3823