View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_low_22 (Length: 264)
Name: NF0614_low_22
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0614_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 35317428 - 35317662
Alignment:
Q |
1 |
ccggttcagctaggtctggtgttataccagttaactctgttggatatgaggttttcttgttgatgcttcagtttctgtacagtggacaagtttctattgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35317428 |
ccggttcagctaggtctggtgttataccagttaactctgttggatatgaggttttcttgttgatgcttcagtttctgtacagtggacaagtttctattgt |
35317527 |
T |
 |
Q |
101 |
tcctcagaaacatgaacctaggcctaattgtggtgaccgtggttgttggcatacacattgtacttcagccgttgatcttgctcttgatactcttgcagcc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35317528 |
tcctcagaaacatgaacctaggcctaattgtggtgaccgtggttgttggcatacacattgtacttcagccgttgatcttgctcttgatactcttgcagcc |
35317627 |
T |
 |
Q |
201 |
gctagatactttggagttgaacagcttgcattact |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
35317628 |
gctagatactttggagttgaacagcttgcattact |
35317662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 19889814 - 19889651
Alignment:
Q |
69 |
cagtttctgtacagtggacaagtttctattgttcctcagaaacatgaacctaggcctaattgtggtgaccgtggttgttggcatacacattgtacttcag |
168 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| | || || |||||||| |||||||| |||| |
|
|
T |
19889814 |
cagtttctgtacagtggacaagtttctattgttcctcagaaacatgagcctagacctaattgtggtgagagagggtgctggcatacgcattgtacctcag |
19889715 |
T |
 |
Q |
169 |
ccgttgatcttgctcttgatactcttgcagccgctagatactttggagttgaacagcttgcatt |
232 |
Q |
|
|
||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
T |
19889714 |
ccgttgatcttgcccttgatactctagctgccgctagatactttggagttgaacagcttgcatt |
19889651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University