View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0614_low_24 (Length: 250)
Name: NF0614_low_24
Description: NF0614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0614_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 31817971 - 31817743
Alignment:
| Q |
12 |
atgaagcaacagaatagggctgaagaagctattgaagctattaaatcacttagaagtagatgctcagatcaagcacaagaatcccttgataatattctct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31817971 |
atgaagcaacagaatagggctgaagaagctattgaagctattaaatcacttagaagtagatgctcagatcaagcacaagaatcccttgataatattctct |
31817872 |
T |
|
| Q |
112 |
tggatctatacaaggtaattaacaccgccaatttttatgattaaattatatttgt-ttttgattcatatcatctatctttagatgttaaaaacatatgct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31817871 |
tggatctatacaaggtaattaacaccgccaatttttatgattaaattatatttgttttttgattcatatcatctatctttagatgttaaaaac------- |
31817779 |
T |
|
| Q |
211 |
agttatatggtgcacaattgatatatgtgttgtactatgc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31817778 |
----atatggtgcacaattgatatatgtgttgtactatgc |
31817743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1965 times since January 2019
Visitors: 3810