View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0615_low_2 (Length: 298)
Name: NF0615_low_2
Description: NF0615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0615_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 8e-27; HSPs: 14)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 69 - 150
Target Start/End: Complemental strand, 29908225 - 29908145
Alignment:
Q |
69 |
ataggtgaaatcctatagatgaaaggtcaattgaataaaattaatgtatttgataaaattagctttagaaagtaaccgataa |
150 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||| |
|
|
T |
29908225 |
ataggtgaaatcttatagatgaaaggtcaattgaataaaa-taatgtattttataaaattagctttagaaagtaatcgataa |
29908145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 29908127 - 29908083
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
T |
29908127 |
gtggtgatcgaggtttgaactccggaccttgcatatattatgcat |
29908083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 7230351 - 7230307
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcat |
7230307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 21114306 - 21114339
Alignment:
Q |
178 |
ggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||||||| |||||||||||||||||||||||| |
|
|
T |
21114306 |
ggtttgaaccccggaccttgcatatatcatgcat |
21114339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 10261759 - 10261803
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
10261759 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
10261803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 20799384 - 20799428
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
20799384 |
gtggtgaccagggtttgaaccccggaccttgcatatattatgcat |
20799428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 21562696 - 21562652
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
21562696 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
21562652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 26926700 - 26926744
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
26926700 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
26926744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 38375028 - 38374984
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| |||||||||||| |||||||||||||| |||||| |
|
|
T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
38374984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 43330217 - 43330173
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
43330217 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
43330173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 49041971 - 49042015
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
49042015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 49385296 - 49385340
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||||||||||| ||| ||||||| |||||| |
|
|
T |
49385296 |
gtggtggccgaggtttgaactccggatcttacatatattatgcat |
49385340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 51450283 - 51450239
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
51450283 |
gtggtggccggggtttgaactccggaccttgcatatcttatgcat |
51450239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 54294412 - 54294456
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
54294412 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
54294456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 47417854 - 47417810
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
T |
47417854 |
gtggtgaccgaggtttgaactccgaaccttgcatatattatgcat |
47417810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 9639807 - 9639851
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| |||||||| |||||||||||||||||||||| |||||| |
|
|
T |
9639807 |
gtggtgtccgaggttcgaactccggaccttgcatatattatgcat |
9639851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 32950759 - 32950795
Alignment:
Q |
175 |
cgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||| |
|
|
T |
32950759 |
cgaggtttgaactccggaccttgcatatattatgcat |
32950795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 34521180 - 34521224
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
34521180 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcat |
34521224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 34595943 - 34595899
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcat |
34595899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 26755680 - 26755643
Alignment:
Q |
174 |
ccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
26755680 |
ccgaggtttgaaccccggaccttgcatatataatgcat |
26755643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 64676 - 64712
Alignment:
Q |
175 |
cgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||||||||||||||||| |||||||||| |||||| |
|
|
T |
64676 |
cgaggtttgaactccggactttgcatatattatgcat |
64712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 21638184 - 21638140
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| |||| |||| |||||||||||||||||||||||| |
|
|
T |
21638184 |
gtggtgtccggggttcgaaccccggaccttgcatatatcatgcat |
21638140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 42045362 - 42045406
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| |||||||||||| |||||||||||||| |||||| |
|
|
T |
42045362 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
42045406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 211
Target Start/End: Complemental strand, 44794962 - 44794920
Alignment:
Q |
169 |
ggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||| |||||| |
|
|
T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcat |
44794920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 27587292 - 27587248
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| |||||||||||||||||||||||| |
|
|
T |
27587292 |
gtggtggccggggtttgaaccccggaccttgcatatatcatgcat |
27587248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 6248369 - 6248335
Alignment:
Q |
170 |
gtgaccgaggtttgaactccggaccttgcatatat |
204 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |
|
|
T |
6248369 |
gtgaccgaggttcgaactccggaccttgcatatat |
6248335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 30176409 - 30176454
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcatg |
212 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| ||||||| |
|
|
T |
30176409 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcatg |
30176454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 6447260 - 6447216
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| | ||| ||||||||||||||||||||||||| |||||| |
|
|
T |
6447260 |
gtggtggctgagatttgaactccggaccttgcatatattatgcat |
6447216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 12748972 - 12748928
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
12748972 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
12748928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 20665353 - 20665397
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
20665353 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
20665397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 27718896 - 27718928
Alignment:
Q |
179 |
gtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||||||||| |||||| |
|
|
T |
27718896 |
gtttgaactccggaccttgcatatattatgcat |
27718928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 29652281 - 29652245
Alignment:
Q |
175 |
cgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||| |
|
|
T |
29652281 |
cgaggtttgaactctggaccttgcatatattatgcat |
29652245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 30550716 - 30550760
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
30550716 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
30550760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 32051522 - 32051566
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
32051522 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
32051566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 44215465 - 44215509
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
44215465 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
44215509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 33824951 - 33824908
Alignment:
Q |
168 |
tggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcat |
33824908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 214
Target Start/End: Complemental strand, 291437 - 291391
Alignment:
Q |
168 |
tggtgaccgaggtttgaactccggaccttgcatatatcatgcatgat |
214 |
Q |
|
|
||||||| | ||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
291437 |
tggtgacgggggtttgaaccccggaccttgcatatattatgcatgat |
291391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 8916464 - 8916501
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatat |
204 |
Q |
|
|
|||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
8916464 |
gtggtggccgagatttgaactccggaccttgcatatat |
8916501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 11982621 - 11982585
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatat |
204 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||| |
|
|
T |
11982621 |
gtggtgaccgaggtt-gaactccggaccttgcatatat |
11982585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 13496176 - 13496143
Alignment:
Q |
178 |
ggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
||||||||||||||||||||||||||| |||||| |
|
|
T |
13496176 |
ggtttgaactccggaccttgcatatattatgcat |
13496143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 247730 - 247686
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
247730 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
247686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 2726407 - 2726451
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||| |||| |||| ||||||||||||||||| |||||| |
|
|
T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcat |
2726451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 4450333 - 4450289
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||| || |||| ||||||||||||||||| |||||| |
|
|
T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcat |
4450289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 4467349 - 4467305
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||| | || ||||||||||||||||||||| |
|
|
T |
4467349 |
gtggtggccgaggtttgagccccagaccttgcatatatcatgcat |
4467305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 8569780 - 8569736
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
8569736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 20017046 - 20017089
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgca |
210 |
Q |
|
|
|||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
T |
20017046 |
gtggtggccgagatttgaactccggaccttgcatatataatgca |
20017089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 3708764 - 3708720
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
3708764 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
3708720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 4056861 - 4056817
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||| || |||||||||||||||||||||| |||||| |
|
|
T |
4056861 |
gtggtgcccgagattcgaactccggaccttgcatatattatgcat |
4056817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 10735821 - 10735865
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
10735821 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 11868652 - 11868696
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
11868652 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
11868696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| |||||||||||| |||||||||||||| |||||| |
|
|
T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 27848229 - 27848185
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
27848229 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
27848185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 29544698 - 29544654
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
29544698 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
29544654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 35360045 - 35360089
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
35360045 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
35360089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 35820291 - 35820335
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||||| ||||||||||||| ||| |||||| |
|
|
T |
35820291 |
gtggtggccgaggtttgaaccccggaccttgcatgtattatgcat |
35820335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 36359385 - 36359341
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| || |||||||||| ||||||||||||||||| |||||| |
|
|
T |
36359385 |
gtggtggccaaggtttgaaccccggaccttgcatatattatgcat |
36359341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 7670497 - 7670461
Alignment:
Q |
175 |
cgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||| ||||||||||||||||| |||||| |
|
|
T |
7670497 |
cgaggtttgaaccccggaccttgcatatattatgcat |
7670461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 16198454 - 16198410
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||| || |||||||||||||||||||||| |||||| |
|
|
T |
16198454 |
gtggtggccgagattcgaactccggaccttgcatatattatgcat |
16198410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 16537526 - 16537570
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||| || ||||||| |||||| |||||| |
|
|
T |
16537526 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcat |
16537570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 16628136 - 16628092
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||| || ||||||| |||||| |||||| |
|
|
T |
16628136 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcat |
16628092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 20763225 - 20763181
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
20763225 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
20763181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 27462426 - 27462470
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
27462470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 29488791 - 29488747
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
29488791 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
29488747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 33232387 - 33232431
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
33232387 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
33232431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 34284529 - 34284573
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
34284529 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
34284573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 37516800 - 37516836
Alignment:
Q |
175 |
cgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||||||||||| | |||||| |
|
|
T |
37516800 |
cgaggtttgaactccggaccttgcatatgttatgcat |
37516836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 42095942 - 42095978
Alignment:
Q |
176 |
gaggtttgaactccggaccttgcatatatcatgcatg |
212 |
Q |
|
|
||||||||||| ||||||||||||||||| ||||||| |
|
|
T |
42095942 |
gaggtttgaaccccggaccttgcatatattatgcatg |
42095978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 47342436 - 47342468
Alignment:
Q |
179 |
gtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||||||||| |||||| |
|
|
T |
47342436 |
gtttgaactccggaccttgcatatattatgcat |
47342468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 20688099 - 20688067
Alignment:
Q |
179 |
gtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||||||||||||||||||| |||||| |
|
|
T |
20688099 |
gtttgaactccggaccttgcatatattatgcat |
20688067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 22522791 - 22522835
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
22522791 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
22522835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 37462182 - 37462138
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
37462182 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
37462138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 40715939 - 40715983
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
40715983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 913590 - 913634
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| | ||||||||||| ||||||||||||||||| |||||| |
|
|
T |
913590 |
gtggtggcagaggtttgaaccccggaccttgcatatattatgcat |
913634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 916510 - 916466
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
916510 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
916466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 10498685 - 10498729
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
T |
10498685 |
gtggtggccgaggtttgaactcatgaccttgcatatattatgcat |
10498729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 16792964 - 16793008
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||||||| ||||||||| | ||||||||||||||| |||||| |
|
|
T |
16792964 |
gtggtgaccggggtttgaaccctggaccttgcatatattatgcat |
16793008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 36623492 - 36623456
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatata |
203 |
Q |
|
|
|||||| ||| |||||||||||||||||||||||||| |
|
|
T |
36623492 |
gtggtggccggggtttgaactccggaccttgcatata |
36623456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 38130949 - 38130993
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
38130949 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
38130993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 44075146 - 44075190
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcat |
44075190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 48849753 - 48849797
Alignment:
Q |
167 |
gtggtgaccgaggtttgaactccggaccttgcatatatcatgcat |
211 |
Q |
|
|
|||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
48849797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2434 times since January 2019
Visitors: 3819