View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_17 (Length: 331)
Name: NF0616_high_17
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 78 - 319
Target Start/End: Complemental strand, 2467908 - 2467667
Alignment:
Q |
78 |
ttgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagcccgaaaaatgttggtgaattgaaagcgtggtggtaatttgagattgc |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2467908 |
ttgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagaccgaaaaatgttggtgaattgaaagcgtggtggtaatttgagattgc |
2467809 |
T |
 |
Q |
178 |
agcgaggagtaggaggggggaaaatggaagaggatataagtgaggtggtgaaagatgaaaagtgctggctcttaaatggttttggaaacgaatggagcga |
277 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2467808 |
agcgaggagtaggagggggaaaaatggaagaggatataagtgaggtggtgaaagataaaaagtgctggctcttaaatggttttggaaacgaatggagcga |
2467709 |
T |
 |
Q |
278 |
atgtgagaaaaagtgtgattgcatttctaattccttcttctg |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2467708 |
atgtgagaaaaagtgtgattgcatttctaattccttcttctg |
2467667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 2468028 - 2467967
Alignment:
Q |
8 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2468028 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacag |
2467967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 189 times since January 2019
Visitors: 3833