View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_20 (Length: 315)
Name: NF0616_high_20
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 131 - 266
Target Start/End: Original strand, 38767163 - 38767298
Alignment:
| Q |
131 |
caggtttgcacataaatcttgatatcatgaaaaataaaaccagggaagaatatcaccagtgataattataataaaacgagcatctcaataagtagcctac |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38767163 |
caggtttgcacataaatcttgatatcatgaaaaataaaaccagggaagaatatcaccagagataattataataaaccgagcatctcaataagtagcctac |
38767262 |
T |
|
| Q |
231 |
attagcaaattaaggttgtgtttggattgatgatga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38767263 |
attagcaaattaaggttgtgtttggattgattatga |
38767298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 772 times since January 2019
Visitors: 3837