View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_22 (Length: 300)
Name: NF0616_high_22
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 75 - 223
Target Start/End: Complemental strand, 31817672 - 31817538
Alignment:
Q |
75 |
caagtgtatagtgcaacactattttatttggcacataaagttagcccaaaaagaa-tttaattttataatcactagtaatggtactaattaaagtcacat |
173 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
31817672 |
caagtgtatagtgcaacactattttatttggcacataaagttagcccaaaaagaattttaattttataatcactagtaatggtactaatta--------- |
31817582 |
T |
 |
Q |
174 |
tttatgatgttgaacaacagagatgtggtaggcttgatgaccaaattgct |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31817581 |
------atgttgaacaacagagatgtggtaggcttgatgaccaaattgct |
31817538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 31817753 - 31817698
Alignment:
Q |
1 |
ttgtactatgcaccattggatcaagtgggatattgacttattgatccaatagtgag |
56 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31817753 |
ttgtactatgcaccattggatcaagtgggatattgacttattgatccaatagtgag |
31817698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 695 times since January 2019
Visitors: 3837