View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_33 (Length: 251)
Name: NF0616_high_33
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 30 - 234
Target Start/End: Complemental strand, 34567774 - 34567579
Alignment:
| Q |
30 |
actgctgccaatgagctcttgactttcattcttgcaaatccaggagatgctttacttgttccaacaccatactatcctgggtaagaagttttctcttttc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34567774 |
actgctgccaatgagctcttgactttcattcttgcaaatccaggagatgctttacttgttccaacaccatactatcctgggtaagaaattttctcttttc |
34567675 |
T |
 |
| Q |
130 |
acacttcaatacatttttatatttttctcttaccataattaataatggaaccttcctataccaaaaataccaaaaattttataatatagtttcaaaatgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34567674 |
acacttcaatacatttttatatttttctcttaccataattaataatggaaccttcctataccaa---------aaattttataatatagtttcaaaatgt |
34567584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 42790191 - 42790103
Alignment:
| Q |
28 |
caactgctgccaatgagctcttgactttcattcttgcaaatccaggagatgctttacttgttccaacaccatactatcctgggtaagaa |
116 |
Q |
| |
|
||||||| || |||||||| || || |||||||||||||| || ||||||||||| |||||||| || || |||||||| ||||||||| |
|
|
| T |
42790191 |
caactgcggctaatgagcttttaaccttcattcttgcaaaccccggagatgctttgcttgttcccaccccttactatccagggtaagaa |
42790103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 42799731 - 42799643
Alignment:
| Q |
28 |
caactgctgccaatgagctcttgactttcattcttgcaaatccaggagatgctttacttgttccaacaccatactatcctgggtaagaa |
116 |
Q |
| |
|
||||||| || |||||||| || || |||||||||||||| || ||||||||||| |||||||| || || |||||||| ||||||||| |
|
|
| T |
42799731 |
caactgcggctaatgagcttttaaccttcattcttgcaaaccccggagatgctttgcttgttcccaccccttactatccagggtaagaa |
42799643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University