View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_36 (Length: 242)
Name: NF0616_high_36
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 53012654 - 53012441
Alignment:
Q |
19 |
atcaaactttaaaagtaaatatatagaacactttaatattatttagaacttttagtactacccaatagaagaattgtgctttatctcaactcaactnnnn |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53012654 |
atcaaactttaaaagtaaatatatagaacactttaatattatttagaacttttagtactacccaatagaagaattgtgctttatctcaactcaactaaaa |
53012555 |
T |
 |
Q |
119 |
nnntaggccgtgcgcatgttagatacgtttgttgtctttagcttctttataaatatgggtcttttatgaaagagagatccactcactaaaatgttccatc |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53012554 |
aaataggccgtgcgcatgttagatacgtttgttgtctttagcttctttataaatatgggtcttttatgaaagagagatccactcactaaaatgttccatc |
53012455 |
T |
 |
Q |
219 |
ttgtctcttctctg |
232 |
Q |
|
|
|||||||||||||| |
|
|
T |
53012454 |
ttgtctcttctctg |
53012441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University