View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_37 (Length: 240)
Name: NF0616_high_37
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_high_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 240
Target Start/End: Complemental strand, 1316910 - 1316674
Alignment:
| Q |
4 |
tcagataagtgatacctgcaaccggaggagctgcttccttcatttccaaagctccacatgctttagatatatcttcaatggcatcactcatgaaatatgt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316910 |
tcagataagtgatacctgcaaccggaggagctgcttccttcatttccaaagctgcacatgctttagatatatcttcaatggcatcactcatgaaatatgt |
1316811 |
T |
 |
| Q |
104 |
aggcaaaaccatgaactactttcatgttgcaataaatactttcctaaattactcgataaggatttggcatatagcaatgtattcaaaaccatattcctgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316810 |
aggcaaaaccatgaactactttcatgttgcaataaatactttcctaaattactcgattaggatttggcatatagcaatgtattcaaaaccatattcctgt |
1316711 |
T |
 |
| Q |
204 |
ctgtttgagagatcgatcaatcattttgcaataaaca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316710 |
ctgtttgagagatcgatcaatcattttgcaataaaca |
1316674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 43487148 - 43487057
Alignment:
| Q |
4 |
tcagataagtgatacctgcaaccggaggagctgcttccttcatttccaaagctccacatgctttagatatatcttcaatggcatcactcatg |
95 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43487148 |
tcagataattgatacctgcaaccggaggagctgcttccttcatttccaaagctgcacatgctttagatatatcttcaatggcatcactcatg |
43487057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 194
Target Start/End: Complemental strand, 43486938 - 43486869
Alignment:
| Q |
125 |
tcatgttgcaataaatactttcctaaattactcgataaggatttggcatatagcaatgtattcaaaacca |
194 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
43486938 |
tcatgttgcacaaaatactttcctaaattactctattaggatttggcatatagcaatgtattcaaaacca |
43486869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University