View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_high_42 (Length: 203)
Name: NF0616_high_42
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_high_42 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 85 - 203
Target Start/End: Original strand, 35423832 - 35423945
Alignment:
| Q |
85 |
attttaaataagtcgttagtgaaaattttcaatacttcatgatccacccacacttgtcttgtctagtctgaactcgcaattattataattattttgacaa |
184 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35423832 |
attttaaataagtcgttagtgaaatttttcaatacctcatgatccacccacacttg-----tctagtctgaactcgcaattattataattattttgacaa |
35423926 |
T |
 |
| Q |
185 |
atatctgacaattattaaa |
203 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35423927 |
atatctgacaattattaaa |
35423945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University