View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0616_high_42 (Length: 203)

Name: NF0616_high_42
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0616_high_42
NF0616_high_42
[»] chr4 (1 HSPs)
chr4 (85-203)||(35423832-35423945)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 85 - 203
Target Start/End: Original strand, 35423832 - 35423945
Alignment:
85 attttaaataagtcgttagtgaaaattttcaatacttcatgatccacccacacttgtcttgtctagtctgaactcgcaattattataattattttgacaa 184  Q
    |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||    
35423832 attttaaataagtcgttagtgaaatttttcaatacctcatgatccacccacacttg-----tctagtctgaactcgcaattattataattattttgacaa 35423926  T
185 atatctgacaattattaaa 203  Q
    |||||||||||||||||||    
35423927 atatctgacaattattaaa 35423945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University