View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_24 (Length: 369)
Name: NF0616_low_24
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_low_24 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 369
Target Start/End: Original strand, 37662186 - 37662547
Alignment:
Q |
30 |
gttagtatcttcctcgaaactctcatatttcagccatactctagtgcttta------------------taattactagtacgtagctagtaagtgtggc |
111 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
37662186 |
gttagtatcttcctcgaaactctcatatttcagccatactctagtgctttagaagcataagttttcttataattactagtacgtagctagtaagtgtggc |
37662285 |
T |
 |
Q |
112 |
tgcttgtgttgaattgagcattgctaaaaaccatgagaaacnnnnnnnnnnn---gagggacatgagaaactatacttatagatatataaattaaacttt |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37662286 |
tgcttgtgttgaattgagcattgctaaaaaccatgagaaacttttttttttttttgagggacatgagaaactatacttatagatatataaattaaacttt |
37662385 |
T |
 |
Q |
209 |
ctggcttctgcatccttttcagtgaaatgtagttggtgtaacaaacaatagataattgagtttatgtctgcaaagtctttt-nnnnnnnnnngaaagagt |
307 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
37662386 |
ctggcttctgcatccttttcagtgaaatgtagttggtgtaacaaacaatagataattgagtttatgtctgcaaagtcttttaaaaaaaaaaaaaaagagt |
37662485 |
T |
 |
Q |
308 |
ttttgcctgcaaagaaagcttatgcagaaattaaattaagcaaggagtggaattataaaata |
369 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
37662486 |
ttttgcctgcaaagaaagcttatgcagaaattaaaataagcaaggagtggaattataaaata |
37662547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2509 times since January 2019
Visitors: 3819