View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_28 (Length: 319)
Name: NF0616_low_28
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 62 - 310
Target Start/End: Original strand, 39608768 - 39609014
Alignment:
| Q |
62 |
ttgtggctgttttatagatttagtatcaaataattgttcttgtttcttatattttataatggagggaatacataattacgattaaatagacttacttttt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39608768 |
ttgtggctgttttatagatttagtatcaaataattgttcttgtttcttatattttataatggagggaatacataattacgattaaatagacttacttttt |
39608867 |
T |
|
| Q |
162 |
tagttatactccattttgttacggaagagggagtatataatttcaatcaaatatatnnnnnnnnnttcttctattttgttacagatgagggaatacataa |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39608868 |
tagttatactccattttgtcacggaagagggagtatataatttcaatcaaatatat--aaaaaatttcttctattttgttacagatgagggaatacataa |
39608965 |
T |
|
| Q |
262 |
ttttgatcaaatctatcatgtacatgtgcttttttgcctgtatattctt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39608966 |
ttttgatcaaatctatcatgtacatgtgcttttttgcctgtattttctt |
39609014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 32 times since January 2019
Visitors: 3832