View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_31 (Length: 314)
Name: NF0616_low_31
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 27 - 219
Target Start/End: Complemental strand, 15884616 - 15884424
Alignment:
| Q |
27 |
tcaataagttcggtgattcggaagtgattgggactaaggatgttgatgttgagaaggctgttgatcttaccaatgatgaggttgatgttactcctgcaaa |
126 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15884616 |
tcaagaagttcggtgattcgaaagtgattgggactaaggatgttgatgctgagaaggctgttgatcttaccaatgatgaggttgatgttactcctgcaaa |
15884517 |
T |
 |
| Q |
127 |
gcgttcatgcccatttgatggtgaaggcagcggtggcaatggaccggtcaagttgttgaagaacatcaaagtggagaaggactagaagttttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15884516 |
gcgttcatgcccatttgatggtgaaggcagcggtggcaatggaccggtcaagttgttgaagaacatcaaagtggagaaggacaagaagttttg |
15884424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University