View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_42 (Length: 260)
Name: NF0616_low_42
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 2811750 - 2811980
Alignment:
| Q |
1 |
cttttttatgctattagtggacttaagactaatattaacttattcaataaaggtggttcgtgggcatttgtattgacaatcgttcctttcgcttgtttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2811750 |
cttttttatgctattagtggacttaagactaatattaacttattcaataaaggtggttcgtgggcatttgtattgacaatcgttcctttaacttgtttgg |
2811849 |
T |
|
| Q |
101 |
gcaagatcgtcgggactgttattgtatcaatccttttcgacttaccagctcgcgatggtattgttcttggtttacttatgaacaccaaaggtcttattga |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2811850 |
gcaagatcatcgggactgttattgtatcaatccttttcgacttaccagctcgcgatggtattgttcttggtttacttatgaacaccaaaggtcttattga |
2811949 |
T |
|
| Q |
201 |
aatgattgtgctcaatattgggagggaacaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2811950 |
aatgattgtgctcaatattgggagggaacaa |
2811980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 289 times since January 2019
Visitors: 3833