View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_44 (Length: 256)
Name: NF0616_low_44
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_low_44 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 29 - 256
Target Start/End: Original strand, 44691064 - 44691300
Alignment:
| Q |
29 |
acttagcttatacgtcaagttaacttggaagaaacaac---------ccatgcaccttttttgttcaaatcctgtgtttagttttaggtaataatacctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44691064 |
acttagcttatacgtcaagttaacttggaagaaacaactcttccaacccatgcaccttttctgttcaaatcctgtgtttagttttaggtactaatacctt |
44691163 |
T |
 |
| Q |
120 |
gggatgattataaggtctgtttgtttggaggatttttgaggcgaggtctaagttgaaannnnnnnaaaattaaaaaacatgataaataatcatatagtag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691164 |
gggatgattataaggtctgtttgtttggaggatttttgaggcgaggtctaagttgaaattttttcaaaattaaaaaacatgataaataatcatatagtag |
44691263 |
T |
 |
| Q |
220 |
agatttccaagatttgtattggtatggaaaattgatc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691264 |
agatttccaagatttgtattggtatggaaaattgatc |
44691300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University