View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0616_low_53 (Length: 234)

Name: NF0616_low_53
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0616_low_53
NF0616_low_53
[»] chr8 (2 HSPs)
chr8 (102-156)||(4580272-4580326)
chr8 (179-220)||(4580345-4580386)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 4580272 - 4580326
Alignment:
102 aattccatcttgatgtttgatcattttcaggtttaggggatgtgttatattgaag 156  Q
    ||||||||||||||||||||||||| | |||||||||||||||||||||||||||    
4580272 aattccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag 4580326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 4580345 - 4580386
Alignment:
179 aaggaatgttatattgaagtttttgatactgtatttgatatt 220  Q
    ||||||||||||||||||||||||||||||||||||||||||    
4580345 aaggaatgttatattgaagtttttgatactgtatttgatatt 4580386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University