View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_53 (Length: 234)
Name: NF0616_low_53
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0616_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 4580272 - 4580326
Alignment:
| Q |
102 |
aattccatcttgatgtttgatcattttcaggtttaggggatgtgttatattgaag |
156 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
4580272 |
aattccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag |
4580326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 4580345 - 4580386
Alignment:
| Q |
179 |
aaggaatgttatattgaagtttttgatactgtatttgatatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4580345 |
aaggaatgttatattgaagtttttgatactgtatttgatatt |
4580386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 332 times since January 2019
Visitors: 3833