View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_55 (Length: 220)
Name: NF0616_low_55
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 2 - 122
Target Start/End: Complemental strand, 4580391 - 4580272
Alignment:
Q |
2 |
ccaagaatatcaaatacagtatcaaaaacttcaatataacattccttnnnnnnnnnnnnnnnnnnncttcaatataacacatcccctaaacctgataatg |
101 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
T |
4580391 |
ccaaaaatatcaaatacagtatcaaaaacttcaatataacattcctt-aaaaaataaaaaataaaacttcaatataacacatcccctaaaccttataatg |
4580293 |
T |
 |
Q |
102 |
atcaaacatcaagatggaatt |
122 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
4580292 |
atcaaacatcaagatggaatt |
4580272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 850 times since January 2019
Visitors: 3837