View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_56 (Length: 213)
Name: NF0616_low_56
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_low_56 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 20 - 213
Target Start/End: Original strand, 35423755 - 35423945
Alignment:
Q |
20 |
atgaagaagataagaaattagagagagaatgaaatttctctcggctnnnnnnnn--ctaggaccggctcccaacaaaattttaaataagtcgttagtgaa |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
35423755 |
atgaagaagataagaaattagagagagaatgaaatttctctcggctaaaaaaaaaactaggaccggctcccgacaaaattttaaataagtcgttagtgaa |
35423854 |
T |
 |
Q |
118 |
aattttcaatacttcatgatccacccacacttgtcttgtctagtctgaactcgcaattattataattattttgacaaatatctgacaattattaaa |
213 |
Q |
|
|
| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35423855 |
atttttcaatacctcatgatccacccaca-----cttgtctagtctgaactcgcaattattataattattttgacaaatatctgacaattattaaa |
35423945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University