View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0616_low_58 (Length: 206)
Name: NF0616_low_58
Description: NF0616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0616_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 10457914 - 10458035
Alignment:
Q |
1 |
aagtatttaatttagatccttattgcatttt-ttaatggatcaataagggtacaactttagcaagcatttccaaatctaaatctctaaaatctgcaaata |
99 |
Q |
|
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
10457914 |
aagtatttaatttagatcctaattgcatttttttaatggatcaataagggtacaacttaagcaagcatttccaaatctaaatctctaaaagctgcaaata |
10458013 |
T |
 |
Q |
100 |
tttctgtttttgcagatctgat |
121 |
Q |
|
|
||| |||| ||||||||||||| |
|
|
T |
10458014 |
tttttgttgttgcagatctgat |
10458035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University