View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0617_low_2 (Length: 213)
Name: NF0617_low_2
Description: NF0617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0617_low_2 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 11483635 - 11483854
Alignment:
| Q |
1 |
caaacatatcatttttgttatatgagtttataaactgtaaactcaaaatctgacattgttggacaaagtttt------acaagaaaagtgattgtttgaa |
94 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
11483635 |
caaacatatcatttttgttatacgagtttataaactataaactcgaaatctgacattgttggacaaagttttgtcaaaacaagaaaaacaattgtttgaa |
11483734 |
T |
|
| Q |
95 |
ttttgagacattc--nnnnnnnnnnngaactagcatcattcaggtcactatgnnnnnnnnnnngcacaattcaggtcactatgttgacaccaaagataag |
192 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11483735 |
ttttgagacattcaatttttttttttgaactagcatcattcaggtcactatatttttttttttgcacaattcaggtcactatgttgacaccaaagataag |
11483834 |
T |
|
| Q |
193 |
aagaattcgtacatattagaa |
213 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
11483835 |
aagaa-tcgtacatattagaa |
11483854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2773 times since January 2019
Visitors: 3829