View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_high_17 (Length: 265)
Name: NF0618_high_17
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0618_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 7150086 - 7150303
Alignment:
| Q |
18 |
caaaggccgcattctattcgagatgtttttcattgtactagtaaagatgctatcattttccattttattctattagtttacaaagtatcaaaataatgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7150086 |
caaaggccgcattctattcgagatgtttttcattgtactagtaaagatgctatcattttccattttattctattagtttacaaagtatcaaaataatgga |
7150185 |
T |
|
| Q |
118 |
gcattatgcgattccattaatttggtnnnnnnnntgctcttccattacgactatgattctatgcaccataaagaacactatttgcggcggttataagtta |
217 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7150186 |
gcattatgcgattccattaa-ttggtaaaaaaaatgctcttccattacgactatgattctctgcaccataaagaacactatttgcggaggttataagtta |
7150284 |
T |
|
| Q |
218 |
aagccacggcggtttgaac |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7150285 |
aagccacggcggtttgaac |
7150303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 127 times since January 2019
Visitors: 3831