View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_high_6 (Length: 386)
Name: NF0618_high_6
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0618_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 98 - 318
Target Start/End: Original strand, 48414968 - 48415188
Alignment:
| Q |
98 |
atcacgctcacgtgctttcatcacagcttctctttcgtatatttcactttcttcacgcctccaattttcttccctctgcatcctttctttttccattcta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48414968 |
atcacgctcacgtgctttcatcacagcttctctttcgtatatttcactttcttcccgcctccaattttcttccctctgcatcctttctttttccattcta |
48415067 |
T |
|
| Q |
198 |
tcaatcacctccaacaatttattctgaagaacctcttggtgattaaccacagttttggtcaatcttttaaagaacactctcatcaaactcatttcttcct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48415068 |
tcaatcacctccaacaatttattctgaagaacctcttggtgattaaccacagttttggtcaatcttttaaagaacactctcatcaaactcatttcttcct |
48415167 |
T |
|
| Q |
298 |
tcagtctcttcctttgcttct |
318 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
48415168 |
tcagtctcttcttttgcttct |
48415188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20 times since January 2019
Visitors: 3832