View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_low_16 (Length: 312)
Name: NF0618_low_16
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0618_low_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 97 - 312
Target Start/End: Original strand, 42271432 - 42271647
Alignment:
| Q |
97 |
ttgttttgataagaaatgtttgtatattttaattacaactaatttactttcttatgtaaaataatttatagaggtgttggatcaaatggagagttacaca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42271432 |
ttgttttgataagaaatgtttgtatattttaattacaactaatttactttcttatgtaaaataatttatagaggtgttgattcaaatggagagttacaca |
42271531 |
T |
|
| Q |
197 |
acaaccaagaaattggagagaatttcttggatggactatcatcaaaaaccatgacaaacactatgtttgatgaaccagcctgtgactatttgaagaaact |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42271532 |
acaaccaagaaattggagagaatttcttggatggactatcatcaaaaaccatgacaaacactatgtttgatgaaccagcttgtgactatttgaagaaact |
42271631 |
T |
|
| Q |
297 |
tggtacaacaagttgg |
312 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
42271632 |
tgatacaacaagttgg |
42271647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 201 times since January 2019
Visitors: 3831